jueves, 11 de junio de 2015

Tres colores para una ciudad

Toulouse es rosa, no rosa a la manera de una idílica canción en que se ve la vida de determinado color, sino rosa de verdad. Rosa en la manera que lo son las piedras que dan forma a la piel de la urbe. Ladrillos rosados apilados tras el paso de pueblos romanos, escenario del exterminio de los cátaros, lugar del martirio de San Saturnino, morada ocasional de Santo Domingo, sepulcro de Santo Tomás de Aquino, rincón de la decapitación de Montmorency, refugio del gobierno republicano español y cuna de "La Resistencia". 



La "Ville Rose" te deja ver su pasado en calles estrechas que se amplían en plazas y bulevares de una ciudad rosácea que suena a tango, pues vio nacer al mismísimo Carlos Gardel.

Toulouse también es azul, uno especial, el que proporciona lo que allí llaman cucaña o cocagne, científicamente "Isatis Tinctoria". Esta planta se extendía por el Languedoc, proporcionando un tinte azul para el paño que a veces se denominaba como azul pastel. Ese azul se diluye en las aguas de los canales, en el atardecer de su playa artificial, azul terroso y voraz en el cauce del Garona, ese río que ha visto tanto…




Toulouse es violeta, ¿no es curioso? Violeta, como la mezcla del rosa y el azul pastel, violeta redundante en las flores violetas del Languedoc, violeta en el perfume que aún perdura en mi ropa blanca, violeta en el sabor de sus caramelos, violeta en el tacto del jabón de manos… También es violeta su alma, el tinte final de sus nubes,  su equipo de fútbol.


Y tres colores dibujan ese rincón del mundo, de Francia, de la literatura de Dumas, de los sueños que a veces me devuelven al Parque de Compans o a la tormenta que con medio cuerpo fuera de la ventana, redondeó una noche más de vino y queso.

domingo, 4 de enero de 2015

Esto no es...



La pipa de Magritte no era una pipa. El paroxismo de la pintura surrealista tenía una lógica aplastante, cartesiana, sencilla, certera. Aquello no era una pipa, jamás lo sería. Era la representación icónica de una pipa, la captura de un objeto, el recuerdo de un elemento, pero no una pipa en sí. Repitió la fórmula con más objetos... un no trozo de queso, una no manzana... Todo lo mismo, no eran lo que eran, sólo era pintura.

   Nos empeñamos en que las cosas, al igual que la mujer del César, no sólo sean algo, sino que lo parezcan. Es importante que ambas dimensiones coincidan y es un completo desastre cuando no lo hacen. No es tanto el hecho de conservar una apariencia rigurosa o conveniente; lo peor es que el parecer te indicara algo que no coincide luego con el ser. En ese momento ni un maestro de la pintura surrealista podría acudir en tu auxilio.

   Dormir con antifaz te deja ver qué cantidad de lágrimas derramas por la noche. Ya he dejado de plantearme el porqué, ya no me importa saber si es un hecho biológico o si lloro en sueños; cualquiera de las dos respuestas me parecería bien, en ambos casos mi cuerpo o mi alma se ve que necesitan que lo haga. Tampoco me importan ya los laberintos que hace meses me agobiaban. He dejado de esperar determinadas palabras por determinados canales. Incluso ha dejado de preocuparme que la letra "e" en el teclado del ordenador no funcione bien. Empiezo a pensar que sentirse sola o acompañada no responde al esquema que nos habían enseñado. Disfruto inconscientemente de cosas que desconocía. Mis obsesiones compulsivas están disparadas y no veo necesidad de frenarlas. Algunos a mi alrededor parecen embarcados en una carrera sin freno por conseguir cosas que parecen tal o cual, a saber lo que son en realidad... pero no me importa, no es mi objetivo, no voy a correr por ello.

   Ha dejado de inquietarme tener el blog abandonado. Esto no es la celebración de su aniversario, es la entrada que coincide con el día en que decidí abrir esta ventanita al mundo, pero solo eso; si parece una conmemoración, pues nada...

   Todo no es lo que parece; bendito maldito Magritte, que razón ha tenido siempre.  

miércoles, 1 de octubre de 2014

Prisioneras de guerra

   Se fue como si tal cosa, sin darle importancia alguna... Parecía que al día siguiente nos íbamos a volver a ver, parecía que aquello no era lo que era... A ninguna en realidad nos gustan las despedidas y por eso aquella se quedó muy lejos de cumplir el protocolo que un adiós impone.
   Sería hipócrita decir que era mi mejor amiga, por desgracia nunca hemos tenido tiempo de emprender esa tarea, pero es de esas tres o cuatro personas que conoces en la universidad que sabes que ya van a estar contigo por siempre, o al menos por mucho tiempo. Curiosamente solo fuimos compañeras de dos asignaturas, puede que las dos peores de la carrera, pero tal vez eso fué lo que nos unió... Entre teoría y práctica, esas dos materias llenaban solitas toda una mañana, que si no recuerdo mal, era la de los miércoles. En cierto modo eso pudo generarnos "el síndrome de los prisioneros de guerra", un lazo afectivo que surge con otra persona que comparte contigo una situación extrema, salvando las distancias.
   Después de aquello ya he dicho que no surgió la historia de comedia made in USA
a lo "mejores amigas del mundo mundial", pero no volvimos a perder el contacto. Un twitteo de risa, algún whatsapp, alguna llamada, un ratito de charla cara a cara... Siempre nos falta tiempo, siempre hay demasiadas cosas que contarse, siempre tengo la sensación de que merecería la pena ajustarse la vida de otra forma para pasar más tiempo con gente como ella...
   Pensar y escribir en esto último me genera una tristeza especial... Hace ya un puñadillo de semanas, un domingo volvió a pasarme lo que suele pasarme mucho últimamente; no estaba donde debía o por estar donde debía no lo estaba donde quería o algún silogismo de este calibre. La cosa fué que no pude ir a la fiesta oficial de despedida, donde todos los que la quieren, que no son pocos, estaban reunidos para decirle adiós.
   Ella, que nunca me hace un reproche aunque sea en broma, no me afeó esto y simplemente, a la semana siguiente, justo el día antes de su partida, en una maniobra casi suicida, se cruzó Sevilla a la peor hora en transporte público para venir a mi casa y decirme que no le gustaban las despedidas y que esto sería un hasta luego, porque el luego será cuando vaya a verla al Norte de Francia donde ahora está.
   Otra aventurera de estas de las que habla el gobierno. Gente que por simple espíritu intrépido deja a su familia, sus amigos y su vida en general para irse a un sitio donde se pondrá de nieve hasta las pestañas y cobrará el sueldo digno que en España cada vez es más inusual. Para colmo, debe ser más arriesgada que nadie, pues le teme a los aviones, pero imagino que forma parte de la historia superar algunas adversidades... Para no perjudicarla en esto, me callé que yo, que no temo a los aparatos volantes, sólo pasé miedo una vez en uno de la compañía con la que ella viajaba. Ahora que está allí puede leerlo.
   Y así se separan un poco más nuestros caminos, con la guerra diaria de vivir en un mundo en crisis de demasiadas cosas. Pero" los prisioneros de guerra" conservan su unión para siempre, las prisioneras compañeras te despiertan con una foto de un bar alucinante donde saben que disfrutarías o en otra versión de despertador, se acuerdan de la fecha de admisión en masters que para tí era importante... Y cada vez que hablamos y el mundo parece algo más pequeño, y Francia no deja de ser la vecindad de al lado, me reafirmo en mi teoría de que no vamos a separarnos, porque siguen las luchas y las guerras cotidianas del tiempo que nos ha tocado en suerte, con Bolonia, con el B1, con sueños y pesadillas... y eso no es soportable si no tienes a cierta clase de gente contigo.
      


Bonne chance, cher ami. 

domingo, 27 de julio de 2014

Como hacerte saber

Es maravilloso a veces eso de que la memoria se atasque. Se queda como atorada en un punto y deja algunos recuerdos con una especie de fundido en negro. Luego, un día que no se sabe porqué, parece que algo se reinicia, se resetea, algo salta y... ¡ahí está! Recuperas algo olvidado y es como una doble alegría, la del conocer y la de un reencuentro extraño; reencuentras algo, te reencuentras contigo.
La vida a veces parece rebobinarse, y acabo de caer en que muchos niños no sabrán que es rebobinarse porque no han conocido ni casettes ni VHS, vaya cosa...
Los recuerdos pegan saltos, adelante, atrás, sin orden, caprichos del destino.
Es curioso encontrarme todas estas espirales ahora que creía que vendría el estancamiento, el freno.
Es agradable tener tiempo de retomar sanas costumbres pasadas. Es genial poder detenerse tanto en nimiedades.  Magnífico esto de poder quedarse con cada frase, cada verdad lacerante, cada consejo de amigo... Es encantador divagar pensando si sería posible que en los colegios se les repitiera a los niños cada mañana este poema, como una oración cívica que deben conocer y repetir de por vida...
Tal vez todos esos balances y análisis con los que me mortifico no son tales, tal vez solo son una revisión que yo no soy capaz de ordenar. Por eso sería más fácil repetirse este poema a diario, asumir cada día un par de verdades y asumir también que no todo el mundo conoce esas verdades. Al fin y al cabo, la intención de don Mario era averiguar cómo hacer saber estas cosas...

COMO HACERTE SABER

¿Cómo hacerte saber que siempre hay tiempo?
Que uno solo tiene que buscarlo y dárselo.
Que nadie establece normas salvo la vida.
Que la vida sin ciertas normas pierde forma.
Que la forma no se pierde con abrirnos.
Que abrirnos no es amar indiscriminadamente.
Que no está prohibido amar.
Que también se puede odiar.
¡Como hacerte saber que nadie establece
normas salvo la vida!...
Que el odio y el amor son afectos.
Que la agresión porque si, hiere mucho.
Que las heridas se cierran.
Que las puertas no deben cerrarse.
Que la mayor puerta es el afecto.
Que los afectos nos definen.
Que definirse no es remar contra la corriente.
Que no cuanto más fuerte se hace el trazo más se dibuja.
Que buscar un equilibrio no implica ser tibio.
Que negar palabras implica abrir distancias.
Que encontrarse es muy hermoso.
Que el sexo forma parte de lo hermoso de la vida.
Que la vida parte del sexo.
Que el "por qué" de los niños tiene un porqué.
Que querer saber de alguien no solo es curiosidad.
Que querer saber todo de todos es curiosidad malsana.
Que nunca está de más agradecer.
Que la autodeterminación no es hacer las cosas solo.
Que nadie quiere estar solo.
Que para no estar solo hay que dar.
Que para dar debimos recibir antes.
Que para que nos den también hay que saber cómo pedir.
Que saber pedir no es regalarse.
Que regalarse es en definitiva no quererse.
Que para que nos quieran debemos mostrar quienes somos.
Que para que alguien sea hay que ayudarlo.
Que ayudar es poder alentar y apoyar.
Que adular no es ayudar.
Que adular es tan pernicioso como dar vuelta la cara.
Que las cosas cara a cara son honestas.
Que nadie es honesto porque no roba.
Que el que roba no es ladrón por placer.
Que cuando no hay placer en hacer las cosas, no se está viviendo.
Que para sentir la vida no hay que olvidarse, que existe la muerte.
Que se puede estar muerto en vida.
Que se siente con el cuerpo y la mente.
Que con los oídos se escucha.
Que cuesta ser sensible y no herirse.
Que herirse no es desangrarse.
Que para no ser heridos levantamos muros.
Que quien siembra muros no recoge nada.
Que casi todos somos albañiles de muros.
Que sería mucho mejor construir puentes.
Que sobre ellos se va a la otra orilla y también se vuelve.
Que volver no implica retroceder.
Que retroceder puede ser también avanzar.
Que no por mucho avanzar se amanece más cerca del Sol.
¡Como hacerte saber, que nadie establece normas, salvo la vida!...

Mario Benedetti

martes, 1 de julio de 2014

El trago



  
Cada año ocurre porque en cierto modo, cada año es cada año porque esto ocurre. Nunca me pilla preparada, nunca me encuentra con mentalidad y actitud propicias aunque este año puede que menos que ninguno. Demasiados ciclos, demasiados círculos, demasiadas celebraciones como para tener ánimo de sumar más... Cada año llega este trago, con la consecuencia de que comienzo a soltar una ristra de lamentos al respecto.. Y no debería, si lo pienso no debería; al fin y al cabo tomo el té sin azúcar, apenas se la echo al café, no le pongo sal a las patatas, porque me gusta que las cosas tengan el sabor que las cosas tienen y sin embargo, este trago, que suele ser agridulce, más lo primero que lo segundo, me cuesta más que cualquier jarabe.
   Todo esto suele envolverme en una terrible espiral de pensamientos y desvaríos encadenados, como si yo no le diera vueltas a la cabeza el resto de días del año... Parece como que se impone la obligación de pararse, de ver el "Debe" y el "Haber", tener o no tener.
   Contra el clásico "Tres cosas hay en la vida, salud, dinero y amor" me gusta más quedarme con lo que dijo George Sand:" ¡Dejadme escapar de la mentirosa y criminal ilusión de la felicidad!  Dadme trabajo, cansancio, dolor y entusiasmo."
   De las tres primeras no tengo nada,  de las otras cuatro podría decirse que hago pleno... ¿puedo quejarme? probablemente no; algún precio tenía que tener escapar de la mentirosa y cruel ilusión de la felicidad...
   George Sand y yo nacimos el mismo día, con un puñado de años de diferencia. Ahí acaban los parecidos pues ni he sido amante de Flaubert ni me he tenido que vestir de hombre para entrar en los bares, ventajas del Siglo XXI, que alguna tenía que tener.
   Los últimos meses han valido por un par de años, los últimos años han hecho por media vida y la media vida que ya se me amontona en el cuentakilómetros se me hace algo pesada en un día como este.
   Es cansino quejarse de este modo, a mí me canso yo misma a base de pura queja, pero es inevitable según parece; aunque por una vez podría dejar el balance a un lado, el conteo de fracasos y cosas parecidas remotamente a éxitos, pero sinceramente, no me veo capaz.
  Un trago que se repite año tras año, deformándote, desfigurándote... Como a ella, como a esa mujer que bebe absenta en un cuadro de extraño granulado porque carece de la inicial capa de imprimación... Seguro que a ella tampoco le gustaba cumplir años, si es que recordaba el día en que tal cosa ocurría...


"La bebedora de absenta"
Pablo Ruíz Picasso

viernes, 7 de febrero de 2014

Cigüeñas perdidas




  Cuentan que en el bolsillo del poeta que murió lejos del hogar, se encontró un papel doblado con este comienzo de poema: "Estos días azules y este sol de la infancia".
   Ya una vez comenté como  mi infancia transcurrió cerca del famoso huerto claro y el célebre limonero de don Antonio... Separados por los años y un  muro que aislaba el convento del palacio vecino y del mundo en general, me gusta pensar que su sol de la infancia era el mismo que el mío, ese que recorría lentamente la sombría calle Dueñas intentando alcanzar todos los recovecos con dificultad... Ese que incluso en verano acariciaba más que abrasaba, como si se volviera especialmente perezoso en esa calle de la ciudad inusualmente tranquila.
 Una  pena que no terminara ese poema... La edad o esta recta final que ante mí se abre, me están devolviendo con caprichosa frecuencia a ese remoto comienzo, a las cosas que añoro y que parece que pasaron hace un siglo, o dos... Y poniéndome algo tonta, me dá por pensar que  habría sido bello que hablara del incesante "tacatacatacatacatacatacatacatacatacataca"  de las cigüeñas que se alojaban temporalmente en la casa de los Alba, camino de África o a la vuelta de esta, nunca tuve claro el recorrido. Era un soniquete que no molestaba pero que invadía las largas horas de silencio en las aulas, ya que siendo unas niñas tan modositas como éramos ese tipo de horas se contaban a puñados.  Hace poco me he dado cuenta de que extrañaba esa insignificancia como extraño tantas otras nimiedades... La Olavide está tan lejos del huerto claro y el limonero como la Luna, y por allí parece que no acostumbran a detenerse aves trashumantes.
    Si a las semanas no muy buenas que llevo  se le suma lo poco que se prodiga el sol últimamente, todos esos recuerdos parecen más lejanos y lacerantes que nunca...  Puede que por eso mismo me alegre mucho ciertos martes de desandar algunos pasos para volver a ese rincón de la Puerta Carmona de donde en cierto modo vengo, para recordar quién soy y porqué lo soy... 
 Pero lo de volver tanto la vista atrás es peligroso, se tiende a idealizar lo remoto, se añora lo que ya no se va a tener y se pierde la perspectiva de buscar un nuevo Sol...
 Aunque, maldita sea, como dijo una vez Eres_mi_cruz merezco vivir en ese palacio, de verdad que me lo estoy ganando...  

sábado, 4 de enero de 2014

Seis años seis



   Nadie diría que han pasado ya seis años, sobre todo viendo en el estado de abandono en que te tengo, mi querido virtual tejado. Nadie pensaría en las alegrías que me has dado, la gente que me permitiste conocer, las historias absurdas que me dejaste lanzar al viento... Seis años son muchos años aunque no demasiados. En seis años he reído y llorado tanto que faltarían letras para dar testimonio aquí, aunque alguno hay... En seis años he cambiado para bien y para mal, no hasta el punto de no reconocerme, pero si hasta el de apreciar un contraste. En seis años de juntar, retorcer y exprimir palabras he aprendido mucho, de mí, de los demás... Seis años de caminos con y sin rumbo, de aulas en Alcosa, de aulas en la Olavide, de sueños, de insomnios y de retornos a esos lugares comunes que me arrepiento de haber abandonado cuando me doy cuenta de que lo he hecho. He dicho tantas veces en esos seis años que no te abandonaría que parezco una amante infiel; he dicho tanto en estos seis años que no te dejaría morir que parezco una mala enfermera... Pero yo soy esa, la que no quiere dejarte, la que se niega a que mueras porque me has dado mucho para permitir eso; ya sabes que no me gusta ir dejando escombros de mí misma por esos mundos de Dios... Por eso mis promesas cumplidas a medias tienen una intención sincera, aunque no las acabe llevando a buen puerto.
   Hace seis años te creé porque tenía una extraña necesidad de escribir; hoy te mentiría si dijera que la sigo teniendo y eso es lo peor de todo; no debería haber perdido eso pero obligaciones de otro tipo me hicieron canalizar mis letras de otra forma y tu, fiel y callado, dejaste que siguiera por otros derroteros.
   A pesar de todo sigo siendo yo, la que disfrutaba haciendo una entrada chorra sobre un desayuno, un viaje o una noche de poco y mal sueño. Me gustaría tanto retomar eso...
   En este 2014  que acabamos de estrenar será la primera vez en que vaya a bordo de un barco más de 12 horas, y me encantaría que en mi primer crucero ocurriera algo como esto:


 Cualquier situación surreal de este tipo, aunque no llegara al delirio de los Hermanos Marx sería algo que no me permitiría no referir aquí, aunque no prometo nada, si no lo hago no incumpliré nada.
   Este año será intenso, el último de la carrera, el de la Graduación y quien sabe cuántas cosas más, y no me gustaría vivir todo eso sin la sensación de saber que tengo una ventana mía, de nadie más, donde puedo compartir lo que acontezca aunque no sea muy interesante, muy lógico o muy leído...
 Y después, quién sabe dónde iremos a parar los dos, han sido muchas las incertidumbres que se me fueron derramando por aquí y ahora parece que esto fue el cuaderno de navegación de un barco que a pesar de todo sí que tenía un rumbo... Me leo y no me reconozco, o tal vez sí, como si no hubiera escrito yo pero si alguien cercano; y es que llevo un rato releyendo entradas antiguas y es como un reencuentro con antiguas amigas.
   En 218 entradas se compusieron retales de un puñado de años, en incontables comentarios recibí muchas cosas.

  Gracias por estos años e incluso gracias por los que vendrán, mi polvoriento virtual tejado.
Related Posts Plugin for WordPress, Blogger...